Go to Top Go to Bottom
Wang, Yang, Wang, Song, Liu, and Wan: Effects of Soybean Small Peptides on Rumen Fermentation and on Intestinal and Total Tract Digestion of Luxi Yellow Cattle

Abstract

Four Luxi beef cattle (400±10 kg) fitted with ruminal, duodenal and ileal cannulas were used in a 4×4 Latin square to assess the effects of soybean small peptide (SSP) infusion on rumen fermentation, diet digestion and flow of nutrient in the gastrointestinal tract. The ruminal infusion of SSP was 0 (control), 100, 200 and 300 g/d. Ruminal SSP infusion linearly (p<0.01) and quadratically (p<0.01) increased microbial protein synthesis and rumen ammonia-N concentration. Concentrations of total volatile fatty acid were linearly increased (p = 0.029) by infusion SSP. Rumen samples were obtained for analysis of microbial ecology by real-time PCR. Populations of rumen Butyrivibrio fibrisolvens, Streptococcus bovis, Ciliate protozoa, Ruminococcus flavefaciens, and Prevotella ruminicola were expressed as a proportion of total Rumen bacterial 16S ribosomal deoxyribonucleic acid (rDNA). Butyrivibrio fibrisolvens populations which related to total bacterial 16S rDNA were increased (p<0.05), while Streptococcus bovis populations were linearly (p = 0.049) and quadratically (p = 0.020) decreased by infusion of SSP. Apparent rumen digestibility of DM and NDF were (Q, p<0.05; L, p<0.05) increased with infusion SSP. Total tract digestion of DM, OM and NDF were linearly (p<0.01) and quadratically (p<0.01) increased by infusing SSP. The flow of total amino acids (AA), essential amino acids (EAA) and individual amino acids were linearly (p<0.01) and quadratically (p<0.01) increased with infusion SSP. The digestibility of Lysine was quadratically (p = 0.033) increased and apparent degradability of Arginine was linearly (p = 0.032) and quadratically (p = 0.042) increased with infusion SSP. The results indicated that infusion SSP could improve nutrient digestion, ruminal fermentation and AA availability.

INTRODUCTION

It has been demonstrated that rumen bacteria use both ammonia-N and non-ammonia-N (NAN; e.g. amino acid, peptides) for bacterial protein synthesis and some species of bacteria prefer NAN to ammonia-N (Russell et al., 1992; Cruz Soto et al., 1994; Griswold et al., 1996). Lindemann et al. (2000) and Dabrowski et al. (2003) showed that supplying peptides offered an advantage over free AA that is easily deaminated in the rumen. However, discrepant results were reported from in vitro studies that assessed the effects of peptides on the rumen metabolism. Whilst some studies showed that rumen bacteria growth, fibre digestion and overall rumen fermentation were improved by supplementation of peptides (Griswold et al., 1996; Carro and Miller, 1999; Russi et al., 2002), this was not observed in other studies (Cruz Soto et al., 1994; Jones et al., 1998). However, there is little information about the effects of supplementation of peptide on rumen microbial activity and on ruminal metabolism in vivo.
Small peptides obtained from proteolytic hydrolysis of different plant proteins have been shown to have various biological and pharmaceutical activities including enhancing growth performance and immunological status (Kotzamanis et al., 2007), offering a more cost-effective way of supplementing AA (Zimmerman et al., 1997; Lindemann et al., 2000; Dabrowski et al., 2003), improving nitrogen retention (Adibi et al., 1993), and increasing mohair fiber growth (Puchala et al., 2002). Zhang et al. (2007) reported that feeding or duodenal infusing SSP, improved nitrogen balance and protein biological value and increased digestibility of dietary nutrients in goats and that supplying SSP by infusing through a duodenum fistula was more efficient than feeding. Liu et al. (2009) also observed increased absorption of small peptides from small the intestine and increased milk protein synthesis by duodenal infusion of SSP. However, information of the effects of SSP on rumen fermentation, microbes and digestive tract metabolism is limited. The objective of this study was to determine the effects of SSP on ruminal fermentation and nutrition digestibility of beef cattle.

MATERIALS AND METHODS

Experimental design and diets

The experiment consisted of four treatments and was conducted in a 4×4 Latin square arrangement using four Luxi Cattle steers (approximate 30 months old) averaging 400±10 kg body weight and fitted with ruminal, proximate duodenal (simple T-piece) and terminal ileal cannula. The fistulation procedures and animal care were according to the experimental protocol that was reviewed and approved by Shandong Academy of Agriculture Sciences. Cattle were fed indoors in individual stalls. Each period lasted for 20 d, comprising a 10-d adaptation and 10-d experiment and sampling. The four treatments were basal diet supplemented with SSP which was produced from proteolytic hydrolysis (ZS Duqing Biotech CO., Ltd., Shandong, China) and dosed by ruminal infusion at the levels of 0, 100, 200 and 300 g/d (denoted as Control, SSP100, SSP200 and SSP300 respectively). The AA composition of the SSP is shown in Table 1. The basal diet (Table 2) was a total mixed ration (TMR) formulated to meet the nutrient requirements of cattle (Feeding Standard of Cattle of the People’s Republic of China, NY/T815- 2004). The TMR was offered in equal amount twice daily at 07:00 and 19:00 for 95% of the ad libitum intake and all cattle had free access to fresh water. The daily amount of SSP of each treatment was dissolved in 1,000 ml of 0.9% physiological saline and was infused using a peristaltic pump (BL-100, Prefluid Technology Company, Jiangsu, China) into the rumen through the ruminal cannula upon morning feeding from d 11 to d 20 at 7:00 clock everyday. Cattle without SSP were infused 1.0 L of physiological saline only (Control).

Sampling and preparations

Samples of feed offered were taken daily during the entire experimental period, composted, oven dried (55°C) and ground to pass 1.0 mm screen for chemical analysis. Duodenal and ileal flow and fecal output were measured by 15 g/d of chromic oxide (Uden et al., 1980), which was given as three boluses of 2.5 g each (7.5 g twice daily at 07:00 and 19:00 h) and administered into the rumen via fistula before feeding on d 11 through 20. On d 18 to 20, samples of duodenal (300 ml) and ileal (200 ml) chyme, faeces (300 g wet basis) and ruminal fluid (200 ml) from the rumen were collected every 6 h daily. The sampling time was adjusted 2 h ahead of the previous day so that samples obtained represented every 2 h during 24-h period (12 total samples). The duodenal, ileal and fecal samples were immediately stored at −20°C, lyophilized and ground in a Wiley mill to pass a 1.00 mm screen for laboratory analysis. Sub-samples of rumen fluid were also strained through four layers of cheesecloth, pH measured immediately using a pH meter (Model PB-20, Sartorius, Germany), and were then stored at −20°C for analysis of ammonia-N, microbial crude protein (MCP) and volatile fatty acids (VFA).
Approximately 200 ml of rumen fluid collected at 6 h after feeding on d 20 of each period was immediately stored at −80°C for determination of the relative quantity to total bacterial 16 S rDNA of Butyrivibrio fibrisolvens, Ruminococcus flavefaciens, Ciliate protozoa, Butyrivibrio fibrisolvens and Streptococcus bovis.

Chemical analysis

Samples were analyzed for total N, DM, OM, Ca and P (AOAC, 1997), and for NDF and ADF (Van Soest et al., 1991). Amino acid analyses were performed according to the methods of the AOAC (1997) using the cationic HPLC system that utilizes post derivatization with ninhydrin followed by UV.
Chromium concentrations of duodenal, ileal, and fecal samples were determined by atomic absorption spectrophotometry with an acetylene/air flame according to the methods of Willams et al. (1962). Rumen fluid samples were analyzed for ammonia N and VFA concentration using methods described by Hu et al. (2005) and for MCP by analyzing purine concentration using method described by Zinn and Owens (1986).
Quantification of microbial 16S rRNA marker genes by RT-PCR: Total DNA was extracted from rumen fluid by a SDS-based DNA extraction method as described by Zhou et al. (1996). The primers of total bacteria, ciliate protozoa, Prevotella ruminicoal, Butyrivibrio fibrisolvens, Ruminococcus flavefaciens and Sreptococus bovis are listed in Table 3, as described by Khafipour et al. (2009) and Stuart and McSweeney (2006). The species-specific real-time quantitative PCR was performed using the Roche 4500 real time PCR system with fluorescence detection of SYBR green dye. Amplification conditions were as follows: one cycle at 95°C for 30 s for initial denaturation and followed by 40 cycles of 95°C for 5 s and 60°C for 20 s. Specificity of amplified products was confirmed by melting temperature and dissociation curves after each amplification. Amplification efficiencies for each primer pair were investigated by examining dilution series of total ruminal microbial DNA template in triplicate.

Data calculation and statistical analysis

Duodenal, ileal, and fecal output for each cattle were calculated as the amount of chromic oxide consumed (g/d) divided by the chromic oxide concentration (g/kg of DM) in the duodenal and ileal chyme or feces (Wang et al., 1998). Nutrient apparently digested in the rumen was calculated as the difference between the nutrient intake (kg/d) and its duodenal flow (kg/d). Nutrient apparently digested in the small intestinal was calculated as the difference between the duodenal flow (kg/d) and ideum flow (kg/d). Nutrient apparently digested in the large intestinal was calculated as the difference between the ideum flow and fecal output (kg/d). Nutrient apparently digested in the total tract was calculated as the difference between the intake and fecal output (kg/d).
The abundance of 16S rRNA marker gene copy number for the ciliate protozoa, P. ruminicola, B. fibrisolvens, R. flavefacien and S.bovis were expressed relative to the copy number of total rumen bacterial 16S rRNA according to the following equation:
Relativequantificationoftarget=2-(Cttarget-Cttotalbacteria)
Where Ct represents threshold cycle.
Data were analyzed as 4×4 Latin square using Mixed procedure of SAS (version 8.0, 2000). The following model was fitted to all variables that did not have repeated measurements over time.
Yijkl=μi+Ci+Pj+Tk+Zl+εijkl
Where Yijkl is the dependent variable, μ is the overall mean, Ci is the effect of cattle (i = 1 to 4), Pj is the effect of period (j = 1 to 4), Tk is the effect of treatment (k = 1 to 4), Zl is the effect of sample time l, and εijkl is the residual error. All terms were considered fixed except for εijkl which was considered random. Polynomial contrasts were used to assess linear and/or quadratic dose-effects of SSP. Differences among treatments were declared significant at p<0.05 using LSMEANS with PDIFF and adjusted with a Dunnett’s test of SAS (2000).

RESULTS

Ruminal fermentation characteristics

In general, increasing the rate of SSP infusion from 100 to 300 g/d increased concentrations of ammonia-N (L, Q; p<0.001), MCP (L, Q; p<0.001) and VFA (L; p = 0.029) and molar proportions of acetate (Q; p<0.05) and propionate (p<0.001), but reduced molar proportion of butyrate (L, p<0.05; Q, p<0.001) and acetate:propionate (A:P) ratio (L, Q; p<0.001; Table 4). Compared to Control, rumen fluid from all SSP infused cattle had higher (p<0.001) concentrations of ammonia-N and MCP, lower (p<0.001) A:P ratio but similar pH. In contrast, effects of SSP on ruminal VFA profile depended on the rate of SSP infusion. Rumen fluid from cattle in SSP200 and SSP300 had higher (p<0.05) concentrations of VFA and higher (p<0.05) molar proportions of propionate than that in Control, whereas these differences were not found between SSP100 and Control.
Infusion of SSP at the rates of 100, 200 and 300 g/d increased (p<0.05) percentage of 16S rRNA gene copies of S. bovis, but did not affect percentages of 16S rRNA gene copies of P. ruminicola, R. flavefaciens or ciliate protozoa in the total bacterial 16S rRNA gene copies as compared to that of Control. In contrast, percentage of 16S rRNA gene copies of B. fibrisolvens was increased (p<0.05) by SSP infused at the rate of 200 g/d but not others.

Nutrient intake, flow and digestibility in gastrointestinal tract

Nutrient intakes and apparent total tract digestibility are presented in Table 5. Because DMI was restrained, intake of DM, OM, NDF, and ADF did not differ among treatments. Nitrogen intake increased as the levels of SSP infusion increasing (p<0.05). The duodenal flow (kg/d) of DM was linearly (p<0.001) and quadratically (p<0.001) decreased and the duodenal flow of NDF was linearly decreased (p = 0.042) by the infusion of SSP. On the contrary, duodenal flow of ADF increased (p<0.05) in cattle receiving 300 g/d of SSP infusion as compared to the control.
Apparent rumen digestibility of DM was quadratically (p<0.05) increased, and apparent rumen digestibility of NDF was linearly (p<0.05) increased, whereas the ileum flow of NDF decreased (L, Q, p<0.05) with the increasing rate of SSP infusion. Similarly, OM digestion in the large intestine and the total tract digestion of DM, OM, and NDF were also linearly and quadratically (p<0.01) increased as the rate of SSP infusion increased.
Ruminal infusion of SSP at the rates up to 300 g/d did not affect N flow to duodenum and ileum or fecal N output, but increased urinary N excretion (L, Q; p<0.001) and N retention (L, Q; p<0.001).

Flux and digestion of AA at different digestive sites

Ruminal infusion of SSP increased (p<0.05) duodenal flux of all 17 AA examined in this study as compared to Control (Table 6). The efficacy of different amounts of SSP on the AA duodenal flux depended on the individual AA with the greatest effects observed at the higher dosage. In general, increasing the amount of infused SSP from 100 to 300 g/d linearly and quadratically increased (p<0.01) increased duodenal flux of 17 AA with the exception of Tyrosine that was only quadratically (p<0.01) increased by the infusion of SSP. Similarly, flux at the terminal ileum of AA examined were also increased (p<0.05) by the ruminal infusion of SSP compared to Control with the exception of Arginine, Threonine, Tyrosine, and Methionine (Table 7). The increased flux of these AA by SSP was also observed in a dose dependent manner and most of them were linearly and/or quadratically (p<0.05) increased as the SSP increased from 100 to 300 g/d. In contrast, the digestibilities of most of the AA examined in the small intestine were not affected by SSP (Table 8) and increased AA digestibility was only observed for Arginine at SSP100, SSP200 and SSP300 and for Lysine at SSP200 (p<0.05).

DISCUSSION

Effect of ruminal SSP infusion on rumen fermentation

In the current study, infusion SSP into the rumen had no effect on ruminal pH, which is consistent with other reports using peptides or sodium caseinate (Cruz Soto et al., 1994; Kazemi et al., 2010). However, ammonia-N was linearly increased as the SSP infusion rate increased, indicating a portion of the infused SSP was degraded and deaminated to ammonia. Increasing crude protein concentration or degradation of dietary protein usually results in increased ammonia concentrations in the rumen (Davidson et al., 2003). Increased ammonia concentration in the rumen was also observed when casein was infused into rumen (Khalili and Huhanen, 2002; Kazemi et al., 2010). Microbial protein synthesized in the rumen is influenced by many factors such as fermentative synchrony of degradable carbohydrate and ruminally degradable protein, ammonia concentration and pH (Fu et al, 2001) and it has been reported that between 18 and 100% microbial protein was derived from ammonia-N Salter et al. (1979). Providing peptides has been shown to stimulate the growth of rumen bacteria (Cruz Soto et al., 1994; Chikunya et al., 1996), and to enhance digestion of fiber (McAllan, 1991; Griswold et al., 1996). The results of this study demonstrated that infusion of SSP in the rumen positively increased microbial crude protein synthesis, which is consistent with another report that showed that supplying peptides and free amino acid to the rumen stimulated microbial yield and fermentation (Chikunya et al., 1996). The enhanced MCP synthesis by SSP infusion may partly due to the increased availability of ammonia-N and the improved synchronization between fermentative energy and ammonia-N (Cruz Soto et al., 1994; Chikunya et al., 1996).
In the present study, rumen concentration of total VFA and molar proportions of propionate were increased but molar proportion of butyrate and acetate: propionate ration were reduced by SSP infusion. This indicated that SSP infusion increased energy supply to the animal as well as improved energy efficiency. Griswold et al. (1996) found total VFA, acetate and butyrate were all increased by adding different amounts and sources of rumen degradable protein. However, Hristov et al. (2004) reported no effect of different rumen degradable protein levels on concentrations of total VFA, acetate, butyrate or propionate in rumen fluid. The discrepancy in the effects of the various forms of rumen degradable proteins on the rumen VFA profile among these studies might be due to the differences in type of animals, diet and the sources of rumen degradable proteins.

Effect of SSP infusion on ruminal microbial communities

This study found that infusion of SSP had no effect on the population of R. flavefaciens, increased the population of B. Fibrisolvens but reduced population of S. bovis. It has been shown that some hemicelluloytic bacteria (e.g., B. fibrisolvens) utilize peptide or AA N directly for microbial protein synthesis (Cotta and Hespell, 1986). F.succinogenes, R. flavefaciens and R. albus are the main cellulolytic bacteria in the rumen (Forsberg et al., 1997) and all of them utilize ammonia-N. The results of this study may suggest that effect of ruminal infusion of SSP on rumen bacteria depend on bacterial capability in utilizing peptide- AA- and ammonia-N.

Effect of SSP infusion on nutrient digestibility

It is generally regarded that ruminally available N in the form of peptides and AA can improve the digestion of both structural carbohydrate and nonstructural carbohydrate by rumen microorganisms. However, the Cornell net carbohydrate and protein system assumes that bacteria fermenting structural carbohydrates do not utilize peptides or amino acid and all their N must come from NH3 (Russell et al., 1992). The improved ruminal digestion of NDF by SSP infusion observed in this study indicated that microbial activity relating to fibre digestion was enhanced by the SSP infusion and this is consistent with the finding of increased microbial protein concentration by infusion of SSP in this study. The digestibility of crude fiber was also increased by addition of SSP in the diet of the goats (Zhang et al., 2004). The exact mechanism by which the microbial activity was increased by supply of SSP is not clear. However, the result that the linear increase of microbial protein was positively associated with the linear increase of ruminal ammonia-N by SSP infusion suggests that increasing the rate of SSP infusion increased the production of ammonia-N thereby enhanced MCP synthesis. Bryant (1973) proposed that ammonia-N in rumen fluid could stimulate the activity of cellulolytic bacteria. On the other hand, Carro and Miller (1999) argued that N forms other than NH3-N are needed for both maximum growth of fiber digesting ruminal microorganisms for maximum fiber digestion. Therefore the increased MCP by SSP infusion might be a combined result of increased ammonia-N and NAN.
Overall, the results of this study showed ruminal infusion of SSP at the rates of 100, 200 and 300 g/d increased the apparent digestibilities of DM, OM, NDF and CP in the total digestive tract of beef cattle. The fact that the improvement in digestibilities of the nutrient by SSP mainly occurred in the rumen indicated that the beneficial effects of supplying SSP on nutrient digestion were mainly through improving rumen fermentation efficiency.

Effect of infusion SSP on AA flow and apparent digestibility of small intestinal

Ruminal infusion of SSP increased all measured AA flux to the small intestine without affecting their digestibility in the small intestine. This suggests that amount of AA absorbed from the small intestine was increased, which is consistent with the observation of an increased amount of N retained due to SSP infusion. The increased AA flux to the small intestine by SPP infusion is likely a combined result of increased flux of ruminal undegradable SPP and MCP. The similar small intestinal digestibility of AA across all the treatments also indicate that the small intestinal digestibility of AA in SPP is similar to that of other feed components used in this study.

IMPLICATIONS

In this experiment, infusion soybean small peptide profoundly influenced ruminal fermentation, duodenal and ileal amino acid flow, and digestion of dry matter, organic matter and fiber. Soybean small peptide may improve the absorption of individual amino acids in the small intestine. But there are still many questions to be answered, including the ruminal degradability of small peptides, the net absorption of intact peptides in the gastrointestinal tract and the influence on microbial population of infusion soybean small peptides, specially the relationship between peptide nitrogen and fiber. More research is needed in this area to determine the intake at which undegraded intake soybean small peptide supplementation becomes beneficial. Although practical application of peptides to livestock nutrition is lacking, further investigations will provide more information, which may enable the improvement of nutritional management decisions.

Table 1
The concentration (mg/g) of total amino acids and peptide amino acids in soybean small peptides
Items Total amino acid content Peptide amino acid content
Aspartic acid 90.91 89.06
Glutamic acid 196.10 189.48
Serine 46.60 46.06
Histidine 19.70 18.97
Glycine 32.60 32.09
Threonine 32.00 30.72
Arginine 62.00 60.85
Alanine 34.90 32.85
Tyrosine 27.60 26.19
Cystine 6.70 6.19
Valine 32.00 30.65
Methionine 12.50 11.45
Phenylalanine 38.20 35.49
Isoleucine 30.80 30.15
Leucine 61.10 55.77
Lysine 55.40 54.59
Proline 52.30 52.29
TAA1 831.41 802.85

1 TAA = Total amino acids.

Table 2
Ingredients and chemical composition of the basal diet (% DM) fed during the experiment
Ingredients Content
  Chinese wild rye 61.61
  Corn 27.00
  Wheat bran 2.89
  Cottonseed meal 6.75
  Calcium hydrogen phosphate 0.35
  Calcium carbonate 0.58
  Sodium chlorid 0.39
  Sodium bicarbonate 0.39
  Minerals premix1 0.04
  Vitamins preminx2 0.19
  Total 100.00
Analyzed composition
  CP % 9.55
  ADF % 27.68
  NDF % 52.27
  Ca % 0.86
Calculated composition
  NEm/(MJ/kg) 6.48

1 Provides per kg of minerals premix: 40 g of Mn, 60 g of Zn, 20 g of Fe, 30 g of Cu, 1.5 g of I, 1 g of Se, 400 mg of Co.

2 Provides per kg of minerals vitamins premix: 30,000,000 IU of vitamin A, 100,000,000 IU of vitamin D, 6,000 mg of vitamin E.

Table 3
PCR primers for real-time PCR assay
Target species Forward/reverses Primer sequence
Butyrivibrio fibrisolvens1 F ACCGCATAAGCGCACGGA
R CGGGTCCATCTTGTACCGATAAAT
Prevotella ruminicoal1 F GCGAAAGTCGGATTAATGCTCTATG
R CCCATCCTATAGCGGTAAACCTTTG
Sreptococus bovis1 F TTCCTAGAGATAGGAAGTTTCTTCGG
R ATGATGGCAACTAACAATAGGGGT
Ruminococcus flavefaciens1 F GAGTGAAGTAGAGGTAAGCGGAATTC
R GCCGTACTCCCCAGGTGG
Ciliate protozoa1 F GCTTTCGWTGGTAGTGTATT
R CTTGCCCTCYAATCGTWCT
Total bacteria2 F CGGCAACGAGCGCAACCC
R CCATTGTAGCACGTGTGTAGCC
Table 4
Effects of soybean small peptide (SSP) infusion into rumen at the rates of 0 (Control), 100 (SSP100), 200 (SSP200) and 300 (SSP300) g/d on characteristics of rumen fermentation and microbial abundance as determined by marker gene copy number in total bacterial 16 S rRNA (percentage of total bacterial 16 S rRNA ) (n = 4)
Item Treatment SEM1 Contrast2


Control SSP100 SSP200 SSP300 L Q
pH 6.54 6.48 6.54 6.56 0.618 0.686 0.820
Ammonia N (mg/L) 66.91c 84.39b 96.79b 116.31a 9.363 <0.001 <0.001
Microbial protein (mg/L) 62.49c 74.99b 82.27b 92.45a 8.594 <0.001 <0.001
Total VFA (mmol/L) 86.03b 89.92ab 91.74a 92.01a 1.313 0.029 0.092
Acetate (mol/100 mol) 75.97a 71.93c 73.74bc 74.35ab 1.035 0.423 0.038
Propionate (mol/100 mol) 13.98c 14.53c 16.48b 19.14a 0.8 <0.001 <0.001
Butyrate (mol/100mol) 10.05b 13.55a 9.78b 6.51c 1.004 0.022 <0.001
Acetate:propionate 5.45a 4.95b 4.49c 3.92d 0.672 <0.001 <0.001
Ruminal microbial
  P. ruminicola (×10−2) 1.94 2.18 2.03 2.21 0.732 0.231 0.437
  R. flavefaciens (×10−2) 5.51 5.91 5.78 5.75 0.832 0.699 0.93
  B. fibrisolvens (×10−4) 1.50b 1.68ab 1.82a 1.70ab 0.622 0.162 0.194
  S. bovis (×10−6) 5.91a 4.87b 4.85b 4.94b 0.801 0.049 0.020
  Ciliate protozoa (×10−2) 3.82 3.83 3.98 3.87 0.771 0.686 0.866

1 SEM = Standard error of mean.

2 p values for the linear (L) or quadratic (Q) effects of SSP infused at the rates 0, 100, 200, 300 g·cattle−1·d−1.

a–d Means within a row with different superscript letter differ (p<0.05).

Table 5
Effects of soybean small peptide (SSP) infusion into rumen at the rates of 0 (Control), 100 (SSP100), 200 (SSP200) and 300 (SSP300) g/d on digestion of nutrient at different digestive sites of Luxi Yellow cattle (n = 4)
Item Treatment SEM1 Contrast2


Control SSP100 SSP200 SSP300 L Q
DM
  Flux to duodenum (kg/d) 4.15a 4.15a 4.07a 3.97b 2.675 <0.001 <0.001
  Flux to ileum (kg/d) 3.21 3.18 3.15 3.14 3.227 0.381 0.677
  Fecal flux (kg/d) 2.71a 2.62b 2.59bc 2.53c 2.569 0.001 0.002
Apparent digestion, of intake (g/100 g)
  Rumen 43.02b 43.14b 44.12b 45.49a 0.918 0.067 0.021
  Small intestine 12.92 13.48 12.63 11.4 1.092 0.184 0.275
  Large intestine 6.94 7.79 7.65 8.39 1.055 0.189 0.436
  Total tract 62.88b 64.41a 64.40a 65.28a 0.905 <0.001 0.002
OM
  Flux to duodenum (kg/d) 3.93a 3.97a 3.91a 3.80b 2.373 0.123 0.153
  Flux to ileum (kg/d) 3.05 3 2.97 2.96 3.319 0.183 0.399
  Fecal flux (kg/d) 2.61a 2.47b 2.47b 2.42b 2.774 <0.001 0.001
Apparent digestion, of intake (g/100 g)
  Rumen 47.54b 47.04b 47.80b 49.26a 0.807 0.981 0.25
  Small intestine 11.77 12.83 12.64 11.23 1.15 0.713 0.484
  Large intestine 5.83 7.13 6.62 7.29 1.072 <0.001 0.001
  Total tract 65.13b 67.00a 67.05a 67.79a 0.943 <0.001 0.001
NDF
  Flux to duodenum (kg/d) 2.17a 2.11ab 2.15ab 2.09b 2.532 0.042 0.136
  Flux to ileum (kg/d) 2.08a 1.98ab 1.99ab 1.94b 2.848 0.022 0.04
  Fecal flux (kg/d) 1.73a 1.71a 1.66b 1.61c 2.224 0.001 0.004
Apparent digestion, of intake (g/100 g)
  Rumen 48.77 50.28 49.26 50.81 0.992 0.042 0.136
  Small intestine 2.22 2.91 3.85 3.42 1.13 0.177 0.31
  Large intestine 8.27 6.22 7.76 7.68 1.106 0.951 0.582
  Total tract 59.26c 59.42c 60.87b 61.91a 0.863 0.001 0.004
ADF
  Flux to duodenum (kg/d) 1.32b 1.34ab 1.34ab 1.38a 2.328 0.068 0.183
  Flux to ileum (kg/d) 1.26 1.24 1.22 1.26 2.627 0.95 0.66
  Fecal flux (kg/d) 1.09 1.05 1.04 1.05 2.366 0.122 0.084
Apparent digestion, of intake (g/100 g)
  Rumen 34.80a 33.70ab 33.84ab 31.84b 1.098 0.068 0.183
  Small intestine 3.07 4.84 5.55 5.61 1.246 0.068 0.137
  Large intestine 8.13 9.52 9.13 10.44 1.161 0.145 0.36
  Total tract 45.99 48.06 48.53 47.90 1.116 0.122 0.085
N
  Intake (g/d) 119.1d 130.4c 142.1a 153.2b 0.71 <0.001 <0.001
  Flux to duodenum (g/d) 121.7 125.0 129.6 132.9 1.71 0.019 0.072
  Flux to ileum (g/d) 51.84 53.31 58.29 62.3 1.611 0.008 0.032
  Fecal flux (g/d) 48.07 47.18 48.91 49.39 1.152 0.406 0.649
  Urinary (g/d) 52.41a 57.65b 55.37c 63.94d 0.908 <0.001 <0.001
  Retain nitrogen (g/d) 18.65c 25.54b 37.77a 39.83a 1.057 <0.001 <0.001

1 SEM = Standard error of mean.

2 p values for the linear (L) or quadratic (Q) effects of SSP infused at the rates 0, 100, 200, 300 g·cattle−1·d−1.

a–d Means within a row with different superscript letter differ (p<0.05).

Table 6
Effects of soybean small peptide (SSP) infusion into rumen at the rates of 0 (Control), 100 (SSP100), 200 (SSP200) and 300 (SSP300) g/d on flux of amino acids at proximate duodenum of Luxi Yelow cattle (n = 4)
Item Treatment SEM1 Contrast2


Control SSP100 SSP200 SSP300 L Q
Aspartic acid 43.20b 45.59b 54.87a 57.74a 1.308 <0.001 <0.001
Glutamic acid 72.26c 78.00b 89.87a 94.24a 1.330 <0.001 <0.001
Serine 29.67c 31.73c 40.66b 44.46a 1.106 <0.001 <0.001
Glycine 23.26bc 22.10c 26.78b 31.57a 1.240 <0.001 <0.001
Histidine 13.86c 17.42b 18.21ab 19.71a 0.968 <0.001 <0.001
Arginine 23.01c 24.95b 27.96a 28.49a 1.010 <0.001 0.002
Threonine 25.04c 26.62bc 29.36ab 30.95a 1.130 <0.001 <0.001
Alanine 30.10b 30.14b 29.76b 36.73a 0.922 0.004 <0.001
Proline 27.79c 31.43b 33.97b 38.12a 1.127 <0.001 <0.001
Tyrosine 17.80ab 15.87c 16.86bc 19.21a 0.979 0.161 0.003
Valine 30.74c 31.96bc 33.39ba 34.38a 1.053 <0.001 0.002
Methionine 8.66b 9.68ba 10.54ba 10.82a 1.019 0.003 0.009
Cystine 8.96c 8.97c 10.17b 12.32a 0.849 <0.001 <0.001
Isoleucine 26.37b 28.36ab 30.27a 30.31a 1.154 0.004 0.009
Leucine 42.02b 44.74b 49.06a 49.93a 1.232 <0.001 <0.001
Phenylalanine 20.59c 23.39b 26.30a 25.07a 0.964 0.002 <0.001
Lysine 25.38d 29.88c 33.50b 35.78a 1.067 <0.001 <0.001
TAA3 468.43b 495.15b 548.73a 583.85a 2.181 <0.001 <0.001
NEAA4 244.08d 254.85c 292.75b 322.07a 1.509 <0.001 <0.001
EAA5 224.63c 245.97b 269.62a 276.85a 1.604 <0.001 <0.001

1 SEM = Standard error of mean.

2 p values for the linear (L) or quadratic (Q) effects of SSP infused at the rates 0, 100, 200, 300 g·cattle−1·d−1.

3 TAA = Total amino acids.

4 NEAA = Non-essential amino acids.

5 EAA = Essential amino acids.

a–d Means within a row with different superscript letter differ (p<0.05).

Table 7
Effects of soybean small peptide (SSP) infusion into rumen at the rates of 0 (Control), 100 (SSP100), 200 (SSP200) and 300 (SSP300) g/d on flux of amino acids at the terminal ilenum of Luxi Yelow cattle (n = 4)
Item Treatment SEM1 Contrast2


Control SSP100 SSP200 SSP300 L Q
Aspartic acid 13.76b 14.49b 17.89a 18.87a 1.015 <0.001 0.005
Glutamic acid 25.26b 26.91ab 31.29ab 32.57a 1.393 0.004 0.018
Serine 12.22c 12.80c 15.19b 17.80a 0.946 <0.001 0.002
Glycine 9.65b 9.02b 10.69ab 12.47a 1.034 0.001 <0.001
Histidine 3.10b 4.06a 4.57a 4.53a 0.790 <0.001 <0.001
Arginine 6.74 6.46 6.28 6.93 0.856 0.780 0.328
Threonine 9.325 9.325 9.88 10.77 1.005 0.049 0.123
Alanine 10.37b 10.18b 10.78ab 13.16a 1.099 0.020 0.018
Proline 12.13b 13.33b 14.09ab 16.27a 1.125 <0.001 0.001
Tyrosine 6.30b 5.62b 6.02b 7.20a 0.807 0.340 0.268
Valine 10.18 10.74 11.40 12.05 1.008 0.007 0.031
Methionine 2.4 2.38 2.58 2.75 0.786 0.107 0.242
Cystine 2.96b 2.91b 2.76b 3.86a 0.836 0.062 0.017
Isoleucine 6.83 7.45 7.74 8.49 0.990 0.018 0.067
Leucine 11.79c 12.38bc 13.13ab 14.34a 0.922 <0.001 0.004
Phenylalanine 6.68c 7.18bc 7.82ab 8.64a 0.853 <0.001 0.001
Lysine 6.43b 6.83ab 7.07ab 8.04a 0.915 0.002 0.007
TAA3 158.04c 162.25bc 179.13b 198.73a 1.787 <0.001 0.001
NEAA4 89.68b 92.35b 105.93a 118.33a 1.658 <0.001 <0.001
EAA5 66.43c 69.91bc 73.20b 80.40a 1.334 <0.001 <0.001

1 SEM = Standard error of mean.

2 p values for the linear (L) or quadratic (Q) effects of SSP infused at the rates 0, 100, 200, 300 g·cattle−1·d−1.

3 TAA = Total amino acids.

4 NEAA = Non-essential amino acids.

5 EAA = Essential amino acids.

a–c Means within a row with different superscript letter differ (p<0.05).

Table 8
Effects of soybean small peptide (SSP) infusion into rumen at the rates of 0 (Control), 100 (SSP100), 200 (SSP200) and 300 (SSP300) g/d on digestion (g/g) of amino acids in the small intestine of Luxi Yelow cattle (n = 4)
Item Treatment SEM1 Contrast2


Control SSP100 SSP200 SSP300 L Q
Aspartic acid 68.00 68.25 68.34 67.22 1.285 0.811 0.924
Glutamic acid 64.94 65.52 62.21 65.35 1.470 0.843 0.930
Serine 58.89 59.66 60.58 59.83 1.316 0.675 0.857
Glycine 59.35 59.11 61.76 60.17 1.531 0.419 0.638
Histidine 77.46 76.61 76.55 76.93 1.331 0.827 0.916
Arginine 70.71b 70.01a 76.74a 75.54a 1.117 0.032 0.042
Threonine 62.74 64.20 64.63 65.18 1.425 0.300 0.575
Alanine 65.44 66.16 65.06 64.18 1.413 0.633 0.845
Proline 56.34 27.48 58.28 57.35 1.540 0.681 0.816
Tyrosine 64.28 64.43 65.82 61.99 1.409 0.784 0.876
Valine 66.79 66.34 65.03 64.97 1.416 0.325 0.622
Methionine 72.31 75.06 76.54 74.61 1.437 0.332 0.291
Cystine 66.87 67.76 68.61 73.22 1.509 0.311 0.299
Isoleucine 74.04 73.69 74.85 71.94 1.463 0.561 0.692
Leucine 71.86 72.25 72.78 70.64 1.328 0.625 0.603
Phenylalanine 67.56ab 69.24ab 70.23a 65.48b 1.212 0.510 0.131
Lysine 74.63b 77.10ab 79.35a 77.52ab 1.232 0.060 0.033
TAA3 66.25 67.12 67.46 65.81 1.228 0.887 0.711
NEAA4 63.23 63.77 63.79 63.23 1.312 0.998 0.948
EAA5 70.42 71.54 72.83 70.95 1.164 0.458 0.149

1 SEM = Standard error of mean.

2 p values for the linear (L) or quadratic (Q) effects of SSP infused at the rates 0, 100, 200, 300 g·cattle−1·d−1.

3 TAA = Total amino acids.

4 NEAA = Non-essential amino acids.

5 EAA = Essential amino acids.

a–b Means within a row with different superscript letter differ (p<0.05).

REFERENCES

Adibi SA, Lochs H, Abumrad NN, Daniel H, Vazquez JA. 1993. Removal of glycylglutamine from plasma by individual tissues: mechanism and impact on amino acid fluxes in postabsorption and starvation. J Nutr 123:325–331.
crossref pmid
Andries JI, Buysse FX, De Brabander DL, Cottyn BG. 1987. Isoacids in ruminant nutrition: their role in ruminal and intermediary metabolism and possible influences on performances-a review. Anim Feed Sci Technol 18:169–180.
crossref
AOAC. 1997. Official methods of analysis. 16th ednAssociation of Official Analytical Chemists; Arlington, Virginia, USA:

Baldwin RL, Allison MJ. 1983. Rumen metabolism. J Anim Sci 57:461–477.
pmid
Bryant MP. 1973. Nutritional requirements of the predominant rumen cellulolytic bacteria. Fed Proc 32:1809–1813.
pmid
Carro MD, Miller EL. 1999. Effect of supplementing a fibre basal diet with different nitrogen forms on ruminal fermentation and microbial growth in an in vitro semi-continuous culture system (RUSITEC). Br J Nutr 82:149–157.
crossref pmid
Cecava MJ, Merchen NR, Berger LL, Fahey GC. 1990. Intestinal supply of amino acids in sheep fed alkaline hydrogen peroxide-treated wheat straw-based diets supplemented with soybean meal or combinations of corn gluten meal and blood meal. J Anim Sci 68:467–477.
crossref pmid
Chalupa W. 1976. Degradation of amino acids by the mixed rumen microbial population. J Anim Sci 43:828–834.
crossref pmid
Chen G, Strobel HJ, Russell JB, Sniffen CJ. 1987. Effect of hydrophobicity on utilization of peptides by ruminal bacteria in vitro. Appl Environ Microbial 53:2021–2025.
crossref
Chikunya S, Newbold CJ, Rode LM, Chen XB, Wallace RJ. 1996. Influence of dietary rumen-degradable protein on bacterial growth in the rumen of sheep receiving different energy sources. Anim Feed Sci Technol 63:333–340.
crossref
Cotta MA, Hespell RB. 1986. Proteolytic activity of the ruminal bacterium Butyrivibrio fibrisolvens. Appl Environ Microbiol 52:51–58.
crossref pmid pmc
Cruz Soto R, Muhammed Samirah A, Newbold CJ, Stewart CS, Wallace RJ. 1994. Influence of peptides, amino acids and urea on microbial activity in the rumen of sheep receiving grass hay and on the growth of rumen bacteria in vitro. Anim Feed Sci Technol 49:151–161.
crossref
Dabrowski K, Lee K, Rinchard J. 2003. The smallest vertebrate, teleost fsh, can utilize synthetic dipeptide based diets. J Nutr 133:4225–4229.
crossref pmid
Davidson S, Hopkins BA, Diaz DE, Bolt SM, Brownie C, Fellner V, Whitlow LW. 2003. Effects of amounts and degradability of dietary protein on lactation, nitrogen utilization, and excretion in early lactation Holstein cows. J Dairy Sci 86:1681–1689.
crossref pmid
Denman SE, McSweeney CS. 2006. Development of a real-time PCR assay for monitoring anaerobic fungal and cellulolytic bacterial populations within the rumen. FEMS Microbiol Ecol 58:572–582.
crossref pmid
Fu CJ, Felton EE, Lehmkuhler JW, Kerley MS. 2001. Ruminal peptide concentration required to optimize microbial growth and efficiency. J Anim Sci 79:1305–1312.
crossref pmid
Gilbert ER, Wong EA, Webb KE. 2008. Board-invited review: peptide absorption and utilization: implications for animal nutrition and health. J Anim Sci 86:2135–2155.
crossref pmid
Griswold KE, Apgar GA, Bouton J, Firkins JL. 2003. Effects of urea infusion and ruminal degradable protein concentration on microbial growth, digestibility, and fermentation in continuous culture. J Anim Sci 81:329–336.
crossref pmid
Griswold KE, Hoover WH, Miller TK, Thayne WV. 1996. Effect of form of nitrogen on growth of ruminal microbes in continuous culture. J Anim Sci 74:483–491.
crossref pmid
Hristov AN, Etter RP, Ropp JK, Grandeen KL. 2004. Effect of dietary crude protein level and degradability on ruminal fermentation and nitrogen utilization in lactating dairy cows. J Anim Sci 82:3219–3229.
crossref pmid
Hu WL, Liu JX, Ye JA, Wu YM, Guo YQ. 2005. Effect of tea saponin on rumen fermentation in vitro. Anim Feed Sci Technol 120:333–339.
crossref
Jones DF, Hoover WH, Miller Webster TK. 1998. Effects of concentrations of peptides on microbial metabolism in continuous culture. J Anim Sci 76:611–616.
crossref pmid
Kazemi-Bonchenari M, Rezayazdi K, Nikkhah A, Kohram H, Dehghan-Banadaky M. 2010. The effects of different levels of sodium caseinate on rumen fermentation pattern, digestibility and microbial protein synthesis of Holstein dairy cows. Afr J Biotechnol 9:1990–1998.
crossref
Khafipour E, Li SC, Plaizier JC, Krause DO. 2009. Rumen microbiome composition determined using two nutritional models of subacute ruminal acidosis. Appl Environ Microbiol 75:7115–7124.
crossref pmid pmc
Khalili H, Huhtanen P. 2002. Effect of casein infusion in the rumen, duodenum or both sites on factors affecting forage intake and performance of dairy cows fed red clover-grass silage. J Dairy Sci 85:909–918.
crossref pmid
Kotzamanis YP, Gisbert E, Gatesoupe FJ, Zambonino Infante J, Cahu C. 2007. Effects of different dietary levels of fish protein hydrolysates on growth, digestive enzymes, gut microbiota, and resistance to Vibrio anguillarum in European sea bass (Dicentrarchus labrax) larvae. Comp Biochem Physiol A: Mol Integr Physiol 147:205–214.
crossref pmid
Lindemann MD, Cromwell GL, Monegue HJ, Cook H, Soltwedel KT, Thomas S, Easter RA. 2000. Feeding value of an enzymatically digested protein for early-weaned pigs. J Anim Sci 78:318–327.
crossref pmid
Liu H, Wang L, Li LS, Wang LB. 2009. Effects of graded duodenal infusion of soybean small peptides on blood indices, milk composition and mRNA expression of PepT1 in small intestine in lactating goats. Chin J Anim Nutr 21319–325.

McAllan AB. 1991. Carbohydrate and nitrogen metabolism in the forestomach of steers given untreated or ammonia treated barley straw diets supplemented with urea or urea plus fishmeal. Anim Feed Sci Technol 33:195–208.
crossref
Newey H, Smyth DH. 1960. Intracellular hydrolysis of dipeptides during intestinal absorption. J Physiol 152:367–380.
crossref pmid pmc
Pittman KA, Bryant MP. 1964. Peptides and other nitrogen sources for growth of Bacteroides ruminicola. J Bacteriol 88:401–410.
crossref pmid pmc
Puchala R, Pierzynowski SG, Wuliji T, Goetsch AL, Sahlu T, Lachica M, Soto-Navarro SA. 2002. Effects of small peptides or amino acids infused to a perfused area of the skin of Angora goats on mohair growth. J Anim Sci 80:1097–1104.
crossref pmid
Remond D, Bernard L, Poncet C. 2000. Free and peptide amino acid net flux across the rumen and the mesenteric- and portal-drained viscera of sheep. J Anim Sci 78:1960–1972.
crossref pmid
Richardson CR, Hatfield EE. 1978. The limiting amino acids in growing cattle. J Anim Sci 46:740–745.
crossref pmid
Russell JB, Wallace RJ. 1997. Energy yielding and energy consuming reactions. The Rumen Microbial Ecosystem. Second EdHobson PN, Stewart CS, editorsSpringer; Heidelberg, Germany: p. 246–282.
crossref
Russell JB, O’Connor JD, Fox DG, Van Soest PJ, Sniffen CJ. 1992. A net carbohydrate and protein system for evaluating cattle diets: I. ruminal fermentation. J Anim Sci 70:3551–3561.
crossref pmid
Russi JP, Wallace RJ, Newbold CJ. 2002. Influence of the pattern of peptide supply on microbial activity in the rumen simulating fermenter (RUSITEC). Br J Nutr 88:73–80.
crossref pmid
SAS. 2000. Users guide. Release 8.1 edSAS Institute Inc; Cary, NC, USA:

Satter LD. 1986. Protein supply from undegraded dietary protein. J Dairy Sci 69:2734–2749.
crossref pmid
Satter LD, Slyter LL. 1974. Effect of ammonia concentration on rumen microbial protein production in vitro. Br J Nutr 32:199–208.
crossref pmid
Scholljegerdes EJ, Ludden PA, Hess BW. 2004. Site and extent of digestion and amino acid flow to the small intestine in beef cattle consuming limited amounts of forage. J Anim Sci 82:1146–1156.
crossref pmid
Skoch SA, Shellig GI, Tucker RE, Mitchell GE. 1975. Interactions of amino acid degradation by rumen microbes. J Anim Sci 40:Suppl. 1197(Abstr.).

Udén P, Colucci PE, Van Soest PJ. 1980. Investigation of chromium, cerium, and cobalt as markers in digesta rate of passage studies. J Sci Food Agric 31:625–632.
crossref pmid
Van Soest PJ. 1982. Nutritional ecology of the ruminant. Comstock, Cornell University Press; Ithaca, NY, USA:

Wang HR, Lu DX, Zhang HY, Zhao XY, Yi Q. 1998. The study on amino acid digestibility in small intestinal of sheep. Neimengu J Anim Sci 2:18–21.

Webb KE, Matthews JC, DiRienzo DB. 1992. Peptide absorption: a review of current concepts and future perspectives. J Anim Sci 70:3248–3257.
crossref pmid
Williams AG, Coleman GS. 1997. The rumen protozoa. The Rumen Microbial Ecosystem. Hobson PN, Stewart CS, editorsBlackie Academic and Professional Publishers; London: p. 73–139.
crossref
Williams CH, David DJ, Iismaa O. 1962. The determination of chromic oxide in faeces samples by atomic absorption spectrophotometry. J Agric Sci 59:381–385.
crossref
Zhang B, Xue LQ, Li LL, Chen YG, Wen GH, Hou DX. 2007. Effects of soybean small peptides on nitrogen balance, nutrient digestibility and several indices in the portal veinous plasma of goats. Small Ruminant Res 72:1–10.
crossref
Zimmerman DR, Sparks JC, Cain CM. 1997. Carry-over responses to an intestinal hydrolysate in weanling pig diets. J Anim Sci 75:Suppl. 171(Abstr.).

Zinn RA, Owens FN. 1986. A rapid procedure for purine measurement and its use for estimating net ruminal protein synthesis. Can J Anim Sci 66:157–166.
crossref


Editorial Office
Asian-Australasian Association of Animal Production Societies(AAAP)
Room 708 Sammo Sporex, 23, Sillim-ro 59-gil, Gwanak-gu, Seoul 08776, Korea   
TEL : +82-2-888-6558    FAX : +82-2-888-6559   
E-mail : editor@animbiosci.org               

Copyright © 2024 by Asian-Australasian Association of Animal Production Societies.

Developed in M2PI

Close layer
prev next